Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_004183 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Hepatic Steatosis | ICD-10 | Fatty (change of) liver, not elsewhere classified (K76.0) |
DBLink | Link to database | PMID | 28717649 |
Experimental Method | |||
Sample Type | HepG2 cells | Comparison | model and control HepG2 cells |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CGTCCATTCCACGAGGTTCT ReverseCCTCTGACGCAGGGTTTCC | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Guo, XY, He, CX, Wang, YQ, Sun, C, Li, GM, Su, Q, Pan, Q, Fan, JG (2017). Circular RNA Profiling and Bioinformatic Modeling Identify Its Regulatory Role in Hepatic Steatosis. Biomed Res Int, 2017:5936171. |